Review



guide rna sequence targeting 5  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc guide rna sequence targeting 5
    Guide Rna Sequence Targeting 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rna sequence targeting 5/product/Addgene inc
    Average 90 stars, based on 5 article reviews
    guide rna sequence targeting 5 - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    90
    Addgene inc guide rna sequence targeting 5
    Guide Rna Sequence Targeting 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rna sequence targeting 5/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    guide rna sequence targeting 5 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    96
    Addgene inc single guide rna sgrna target sequence 5 caccggtacacggtgaactcgtgcg
    Single Guide Rna Sgrna Target Sequence 5 Caccggtacacggtgaactcgtgcg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single guide rna sgrna target sequence 5 caccggtacacggtgaactcgtgcg/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    single guide rna sgrna target sequence 5 caccggtacacggtgaactcgtgcg - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    90
    Sangon Biotech ampk-targeting single guide (sg) rna sequences (ampk exon 1, sg1: 5′-gaagatcggccactacattc-3′; sg2: 5′- tacattctgggtgacacgct-3′)
    Ampk Targeting Single Guide (Sg) Rna Sequences (Ampk Exon 1, Sg1: 5′ Gaagatcggccactacattc 3′; Sg2: 5′ Tacattctgggtgacacgct 3′), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ampk-targeting single guide (sg) rna sequences (ampk exon 1, sg1: 5′-gaagatcggccactacattc-3′; sg2: 5′- tacattctgggtgacacgct-3′)/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    ampk-targeting single guide (sg) rna sequences (ampk exon 1, sg1: 5′-gaagatcggccactacattc-3′; sg2: 5′- tacattctgggtgacacgct-3′) - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Millipore guide rna sequence targeting human tlk1 exon 10 (5′-taactgttgtaaagtgcccg-3′)
    Loss of TLK Activity Compromises Heterochromatin Maintenance (A) Schematic depicting experimental design of ATAC experiments in U-2-OS. (B) Chromatin accessibility changes in U-2-OS upon TLK depletion are statistically significant in 10% of the genome (n = 2) (left panel). Genome annotation of peaks with statistically significant negative (2559 peaks) or positive (2941 peaks) FC upon TLK depletion (right panel). See and for additional information. (C) Representative Integrative Genomics Viewer (IGV) tracks of ATAC-seq reads of an intronic region (top panel) and intergenic region (bottom panel) that become more accessible upon TLK loss. (D) Boxplots of ATAC-seq FC (siTLK1+2 relative to siCont) through different ChromHMM states. (E) Boxplots of ATAC-seq FC relative to siCont computed in regions that do or do not overlap with H3K9me3 chromatin immunoprecipitation sequencing (ChIP-seq) (GEO: GSM788078 ). (F) Heatmap of the correlation relationship grouped using hierarchical clustering between ATAC-seq FC (relative to siCont) and large-scale chromatin features at 10-kb resolution. (G) ATAC-qPCR analysis of open chromatin at selected genomic regions in U-2-OS. Data of quantitative real-time PCR amplification are normalized to RNA Pol II promoter region and represented relative to the signal obtained in siCont, which was set to 1 (n = 2). (H) Representative IF images of HP1α staining in U-2-OS (left panel). High-throughput microscopy (HTM) quantification of chromatin-bound HP1α levels (right panel). Data are from one biological replicate with n >300 nuclei analyzed and are representative of three biological replicates. Median is shown in red. (I) Schematic depicting experimental design of ATAC experiments in HeLa LT. (J) Genome annotation of peaks with statistically significant negative (586 peaks for siCont, 70 peaks for siTLK2) or positive (105 peaks for siCont, 137 peaks for siTLK2) FC upon <t>TLK1/2</t> loss (n = 2). (K) ATAC-qPCR at selected genomic regions in HeLa LT as in (G) (n = 2). (L) Boxplots depicting ATAC-seq FC relative to siCont computed in regions that do or do not overlap with H3K9me3 ChIP-seq (GEO: GSM788078 ). ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05; unpaired t test with Welch’s correction (H), unpaired t test (G and K).
    Guide Rna Sequence Targeting Human Tlk1 Exon 10 (5′ Taactgttgtaaagtgcccg 3′), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rna sequence targeting human tlk1 exon 10 (5′-taactgttgtaaagtgcccg-3′)/product/Millipore
    Average 90 stars, based on 1 article reviews
    guide rna sequence targeting human tlk1 exon 10 (5′-taactgttgtaaagtgcccg-3′) - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    GenScript corporation snx3 crispr guide rna (grna) plasmid (grna targeting sequence: 5′-cggccgacccccaccgtttg-3′)
    Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of <t>CRISPR/Cas9-mediated</t> Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.
    Snx3 Crispr Guide Rna (Grna) Plasmid (Grna Targeting Sequence: 5′ Cggccgacccccaccgtttg 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snx3 crispr guide rna (grna) plasmid (grna targeting sequence: 5′-cggccgacccccaccgtttg-3′)/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    snx3 crispr guide rna (grna) plasmid (grna targeting sequence: 5′-cggccgacccccaccgtttg-3′) - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    Loss of TLK Activity Compromises Heterochromatin Maintenance (A) Schematic depicting experimental design of ATAC experiments in U-2-OS. (B) Chromatin accessibility changes in U-2-OS upon TLK depletion are statistically significant in 10% of the genome (n = 2) (left panel). Genome annotation of peaks with statistically significant negative (2559 peaks) or positive (2941 peaks) FC upon TLK depletion (right panel). See and for additional information. (C) Representative Integrative Genomics Viewer (IGV) tracks of ATAC-seq reads of an intronic region (top panel) and intergenic region (bottom panel) that become more accessible upon TLK loss. (D) Boxplots of ATAC-seq FC (siTLK1+2 relative to siCont) through different ChromHMM states. (E) Boxplots of ATAC-seq FC relative to siCont computed in regions that do or do not overlap with H3K9me3 chromatin immunoprecipitation sequencing (ChIP-seq) (GEO: GSM788078 ). (F) Heatmap of the correlation relationship grouped using hierarchical clustering between ATAC-seq FC (relative to siCont) and large-scale chromatin features at 10-kb resolution. (G) ATAC-qPCR analysis of open chromatin at selected genomic regions in U-2-OS. Data of quantitative real-time PCR amplification are normalized to RNA Pol II promoter region and represented relative to the signal obtained in siCont, which was set to 1 (n = 2). (H) Representative IF images of HP1α staining in U-2-OS (left panel). High-throughput microscopy (HTM) quantification of chromatin-bound HP1α levels (right panel). Data are from one biological replicate with n >300 nuclei analyzed and are representative of three biological replicates. Median is shown in red. (I) Schematic depicting experimental design of ATAC experiments in HeLa LT. (J) Genome annotation of peaks with statistically significant negative (586 peaks for siCont, 70 peaks for siTLK2) or positive (105 peaks for siCont, 137 peaks for siTLK2) FC upon TLK1/2 loss (n = 2). (K) ATAC-qPCR at selected genomic regions in HeLa LT as in (G) (n = 2). (L) Boxplots depicting ATAC-seq FC relative to siCont computed in regions that do or do not overlap with H3K9me3 ChIP-seq (GEO: GSM788078 ). ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05; unpaired t test with Welch’s correction (H), unpaired t test (G and K).

    Journal: Cell Reports

    Article Title: Tousled-Like Kinases Suppress Innate Immune Signaling Triggered by Alternative Lengthening of Telomeres

    doi: 10.1016/j.celrep.2020.107983

    Figure Lengend Snippet: Loss of TLK Activity Compromises Heterochromatin Maintenance (A) Schematic depicting experimental design of ATAC experiments in U-2-OS. (B) Chromatin accessibility changes in U-2-OS upon TLK depletion are statistically significant in 10% of the genome (n = 2) (left panel). Genome annotation of peaks with statistically significant negative (2559 peaks) or positive (2941 peaks) FC upon TLK depletion (right panel). See and for additional information. (C) Representative Integrative Genomics Viewer (IGV) tracks of ATAC-seq reads of an intronic region (top panel) and intergenic region (bottom panel) that become more accessible upon TLK loss. (D) Boxplots of ATAC-seq FC (siTLK1+2 relative to siCont) through different ChromHMM states. (E) Boxplots of ATAC-seq FC relative to siCont computed in regions that do or do not overlap with H3K9me3 chromatin immunoprecipitation sequencing (ChIP-seq) (GEO: GSM788078 ). (F) Heatmap of the correlation relationship grouped using hierarchical clustering between ATAC-seq FC (relative to siCont) and large-scale chromatin features at 10-kb resolution. (G) ATAC-qPCR analysis of open chromatin at selected genomic regions in U-2-OS. Data of quantitative real-time PCR amplification are normalized to RNA Pol II promoter region and represented relative to the signal obtained in siCont, which was set to 1 (n = 2). (H) Representative IF images of HP1α staining in U-2-OS (left panel). High-throughput microscopy (HTM) quantification of chromatin-bound HP1α levels (right panel). Data are from one biological replicate with n >300 nuclei analyzed and are representative of three biological replicates. Median is shown in red. (I) Schematic depicting experimental design of ATAC experiments in HeLa LT. (J) Genome annotation of peaks with statistically significant negative (586 peaks for siCont, 70 peaks for siTLK2) or positive (105 peaks for siCont, 137 peaks for siTLK2) FC upon TLK1/2 loss (n = 2). (K) ATAC-qPCR at selected genomic regions in HeLa LT as in (G) (n = 2). (L) Boxplots depicting ATAC-seq FC relative to siCont computed in regions that do or do not overlap with H3K9me3 ChIP-seq (GEO: GSM788078 ). ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05; unpaired t test with Welch’s correction (H), unpaired t test (G and K).

    Article Snippet: Guide RNA sequence targeting human TLK1 exon 10 (5′-TAACTGTTGTAAAGTGCCCG-3′) , Sigma-Aldrich , N/A.

    Techniques: Activity Assay, ChIP-sequencing, Real-time Polymerase Chain Reaction, Amplification, Staining, High Throughput Screening Assay, Microscopy

    TLK Depletion Activates Innate Immune Signaling (A) Boxplots of RNA-seq noncoding expression, such as antisense RNA or lincRNA, relative to siCont (n = 2). (B) Analysis of repetitive RNA expression (RNA-seq, n = 2). FC in RNAs (siTLK1+2 versus siCont) transcribed from different repeat types was ranked from highest to lowest. Horizontal dotted line represents a cut-off of 2 SD from the mean. Repeats enriched more than 2 SD from the mean are labeled, and colors represent the RepeatMasker broad repeat class to which that repeat type belongs. (C) Expression of DNA repetitive elements by quantitative real-time PCR in U-2-OS. Data are normalized to B-actin, and expression in siCont conditions was set to 1 (n = 5 Sat-α/Satellite2/17-alphoid, n = 6 HERV-H, n = 3 HERV-K, n = 4 Alu/5S rDNA). (D) Volcano plot representing gene expression profile of siTLK1+2 versus siCont obtained from RNA-seq in U-2-OS (n = 2). Gray dots indicate genes, and green dots represent the most downregulated genes together with TLK1 and TLK2. Red dots represent genes belonging to the IFN response. The p values and FC are computed by fitting a linear model with the R package limma. See and for additional data. (E) GO analysis (enrichment biological process) of RNA-seq differentially upregulated genes upon TLK1/2 knockdown. (F) GSEA of RNA-seq positively enriched genes related to innate immunity corresponding to the samples siTLK1+2 versus siCont. (G) GSEA plots of selected differentially expressed gene categories corresponding to the RNA-seq samples siTLK1+2 versus siCont. (H) Validation of expression levels of RNA and DNA sensors and IFN response genes by quantitative real-time PCR in U-2-OS. Data analyzed as in (C) (n = 4). (I) Expression levels of IFN response genes by quantitative real-time PCR in HeLa LT. Data were analyzed as in (C) (n = 3). (J) Expression levels of IFN response genes by quantitative real-time PCR in GM847. Data were analyzed as in (C) (n = 3). (K) CXCL10 concentration was measured in the supernatant of U-2-OS 96 h after siRNA treatment by ELISA (n = 2). ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05; unpaired t test, one-tailed (C and H–J).

    Journal: Cell Reports

    Article Title: Tousled-Like Kinases Suppress Innate Immune Signaling Triggered by Alternative Lengthening of Telomeres

    doi: 10.1016/j.celrep.2020.107983

    Figure Lengend Snippet: TLK Depletion Activates Innate Immune Signaling (A) Boxplots of RNA-seq noncoding expression, such as antisense RNA or lincRNA, relative to siCont (n = 2). (B) Analysis of repetitive RNA expression (RNA-seq, n = 2). FC in RNAs (siTLK1+2 versus siCont) transcribed from different repeat types was ranked from highest to lowest. Horizontal dotted line represents a cut-off of 2 SD from the mean. Repeats enriched more than 2 SD from the mean are labeled, and colors represent the RepeatMasker broad repeat class to which that repeat type belongs. (C) Expression of DNA repetitive elements by quantitative real-time PCR in U-2-OS. Data are normalized to B-actin, and expression in siCont conditions was set to 1 (n = 5 Sat-α/Satellite2/17-alphoid, n = 6 HERV-H, n = 3 HERV-K, n = 4 Alu/5S rDNA). (D) Volcano plot representing gene expression profile of siTLK1+2 versus siCont obtained from RNA-seq in U-2-OS (n = 2). Gray dots indicate genes, and green dots represent the most downregulated genes together with TLK1 and TLK2. Red dots represent genes belonging to the IFN response. The p values and FC are computed by fitting a linear model with the R package limma. See and for additional data. (E) GO analysis (enrichment biological process) of RNA-seq differentially upregulated genes upon TLK1/2 knockdown. (F) GSEA of RNA-seq positively enriched genes related to innate immunity corresponding to the samples siTLK1+2 versus siCont. (G) GSEA plots of selected differentially expressed gene categories corresponding to the RNA-seq samples siTLK1+2 versus siCont. (H) Validation of expression levels of RNA and DNA sensors and IFN response genes by quantitative real-time PCR in U-2-OS. Data analyzed as in (C) (n = 4). (I) Expression levels of IFN response genes by quantitative real-time PCR in HeLa LT. Data were analyzed as in (C) (n = 3). (J) Expression levels of IFN response genes by quantitative real-time PCR in GM847. Data were analyzed as in (C) (n = 3). (K) CXCL10 concentration was measured in the supernatant of U-2-OS 96 h after siRNA treatment by ELISA (n = 2). ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05; unpaired t test, one-tailed (C and H–J).

    Article Snippet: Guide RNA sequence targeting human TLK1 exon 10 (5′-TAACTGTTGTAAAGTGCCCG-3′) , Sigma-Aldrich , N/A.

    Techniques: RNA Sequencing Assay, Expressing, RNA Expression, Labeling, Real-time Polymerase Chain Reaction, Concentration Assay, Enzyme-linked Immunosorbent Assay, One-tailed Test

    ALT Induction Contributes to Innate Immunity Following TLK1/2 Depletion (A) Telomeric C-circle quantification in HeLa LT. TelC signal was normalized by Alu signal (n = 2). Representative slot blot shown in top panel. (B) Expression levels of STING and RSAD2 by quantitative real-time PCR in HeLa LT cells 48 h after treatment with corresponding siRNAs. Data are normalized to B-actin and siCont expression set to 1 (n = 2). (C) Telomeric C-circle quantification in U-2-OS. TelC signal was normalized by Alu signal (n = 3). Representative slot blot shown in top panel. (D) Expression levels of RSAD2 by quantitative real-time PCR in U-2-OS 48 h after siRNA treatment. Data analyzed as in (B) (n = 4). (E) Western blot showing TLK depletion and TRF1-FokI expression in U-2-OS 48 h after siRNA and 24 h after TRF1-FokI transfection. Ponceau staining shown as a loading control. (F) Telomeric C-circle quantification in U-2-OS expressing TRF1-FokI. TelC signal was normalized by Alu signal (n = 3). Representative slot blot shown in left panel. (G) Expression levels of STING by quantitative real-time PCR in U-2-OS cells treated as in (E). Data analyzed as in (B) (n = 3). ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05; unpaired t test (A–D and G).

    Journal: Cell Reports

    Article Title: Tousled-Like Kinases Suppress Innate Immune Signaling Triggered by Alternative Lengthening of Telomeres

    doi: 10.1016/j.celrep.2020.107983

    Figure Lengend Snippet: ALT Induction Contributes to Innate Immunity Following TLK1/2 Depletion (A) Telomeric C-circle quantification in HeLa LT. TelC signal was normalized by Alu signal (n = 2). Representative slot blot shown in top panel. (B) Expression levels of STING and RSAD2 by quantitative real-time PCR in HeLa LT cells 48 h after treatment with corresponding siRNAs. Data are normalized to B-actin and siCont expression set to 1 (n = 2). (C) Telomeric C-circle quantification in U-2-OS. TelC signal was normalized by Alu signal (n = 3). Representative slot blot shown in top panel. (D) Expression levels of RSAD2 by quantitative real-time PCR in U-2-OS 48 h after siRNA treatment. Data analyzed as in (B) (n = 4). (E) Western blot showing TLK depletion and TRF1-FokI expression in U-2-OS 48 h after siRNA and 24 h after TRF1-FokI transfection. Ponceau staining shown as a loading control. (F) Telomeric C-circle quantification in U-2-OS expressing TRF1-FokI. TelC signal was normalized by Alu signal (n = 3). Representative slot blot shown in left panel. (G) Expression levels of STING by quantitative real-time PCR in U-2-OS cells treated as in (E). Data analyzed as in (B) (n = 3). ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05; unpaired t test (A–D and G).

    Article Snippet: Guide RNA sequence targeting human TLK1 exon 10 (5′-TAACTGTTGTAAAGTGCCCG-3′) , Sigma-Aldrich , N/A.

    Techniques: Dot Blot, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Transfection, Staining

    TLK Expression Correlates with Suppressed Innate Immune Signaling in Human Cancer (A) Correlation between TLK1/TLK2 and STING ( TMEM173 ) in the TCGA datasets of low-grade glioma (LGG), liver hepatocellular carcinoma (LIHC), and lung adenocarcinoma (LUAD). (B) Heatmaps with correlations of expression levels of TLK1 and TLK2 with CIN signature, aneuploidy score, STING ( TMEM173 ), and signatures of tumor-immune populations across different TCGA datasets. Stars indicate adjusted p values for multiple comparisons using Benjamini-Hochberg ( ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05). (C) Boxplot of expression levels of genes, CIN signature, aneuploidy score, and different signatures of tumor-immune populations. Analysis was performed in different merged TCGA datasets where TMM status was defined. Stars indicate adjusted p values for multiple comparisons using Benjamini-Hochberg ( ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05). (D) Model of how TLK activity maintains heterochromatin state and its loss promotes spurious transcription and telomere recombination, triggering an innate immune response.

    Journal: Cell Reports

    Article Title: Tousled-Like Kinases Suppress Innate Immune Signaling Triggered by Alternative Lengthening of Telomeres

    doi: 10.1016/j.celrep.2020.107983

    Figure Lengend Snippet: TLK Expression Correlates with Suppressed Innate Immune Signaling in Human Cancer (A) Correlation between TLK1/TLK2 and STING ( TMEM173 ) in the TCGA datasets of low-grade glioma (LGG), liver hepatocellular carcinoma (LIHC), and lung adenocarcinoma (LUAD). (B) Heatmaps with correlations of expression levels of TLK1 and TLK2 with CIN signature, aneuploidy score, STING ( TMEM173 ), and signatures of tumor-immune populations across different TCGA datasets. Stars indicate adjusted p values for multiple comparisons using Benjamini-Hochberg ( ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05). (C) Boxplot of expression levels of genes, CIN signature, aneuploidy score, and different signatures of tumor-immune populations. Analysis was performed in different merged TCGA datasets where TMM status was defined. Stars indicate adjusted p values for multiple comparisons using Benjamini-Hochberg ( ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05). (D) Model of how TLK activity maintains heterochromatin state and its loss promotes spurious transcription and telomere recombination, triggering an innate immune response.

    Article Snippet: Guide RNA sequence targeting human TLK1 exon 10 (5′-TAACTGTTGTAAAGTGCCCG-3′) , Sigma-Aldrich , N/A.

    Techniques: Expressing, Activity Assay

    Journal: Cell Reports

    Article Title: Tousled-Like Kinases Suppress Innate Immune Signaling Triggered by Alternative Lengthening of Telomeres

    doi: 10.1016/j.celrep.2020.107983

    Figure Lengend Snippet:

    Article Snippet: Guide RNA sequence targeting human TLK1 exon 10 (5′-TAACTGTTGTAAAGTGCCCG-3′) , Sigma-Aldrich , N/A.

    Techniques: Functional Assay, Recombinant, Transfection, Plasmid Preparation, Protease Inhibitor, Protein Extraction, Purification, Gel Extraction, Enzyme-linked Immunosorbent Assay, Sequencing, Software, Inverted Microscopy, Sonication

    Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

    Journal: The Journal of Cell Biology

    Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

    doi: 10.1083/jcb.201806153

    Figure Lengend Snippet: Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

    Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

    Techniques: CRISPR, SDS Page, Two Tailed Test, Fluorescence, Western Blot, Expressing

    SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

    Journal: The Journal of Cell Biology

    Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

    doi: 10.1083/jcb.201806153

    Figure Lengend Snippet: SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

    Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

    Techniques: SDS Page, Transfection, Construct, Two Tailed Test

    Evidence for two independent types of ETC responsible for the endosome-to-TGN transport of CI-M6PR in mammalian cells. In mammalian cells, CI-M6PR can be sorted into ETCs that depend on retromer/SNX3 and are tethered by GCC88 at the TGN. Alternatively, CI-M6PR can be sorted into ETCs that are independent of retromer but depend on SNX-BAR proteins and are tethered by golgin-245 at the TGN. The recently identified bridging protein TBC1D23 is not required for tethering of the GCC88-dependent ETCs but is required for the tethering of ETC by golgin-245.

    Journal: The Journal of Cell Biology

    Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

    doi: 10.1083/jcb.201806153

    Figure Lengend Snippet: Evidence for two independent types of ETC responsible for the endosome-to-TGN transport of CI-M6PR in mammalian cells. In mammalian cells, CI-M6PR can be sorted into ETCs that depend on retromer/SNX3 and are tethered by GCC88 at the TGN. Alternatively, CI-M6PR can be sorted into ETCs that are independent of retromer but depend on SNX-BAR proteins and are tethered by golgin-245 at the TGN. The recently identified bridging protein TBC1D23 is not required for tethering of the GCC88-dependent ETCs but is required for the tethering of ETC by golgin-245.

    Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

    Techniques: